Patterns of Intelligence

 

Chapter 6: Patterns of Intelligence

DNA exists only inside of cells. DNA provides templates and instructions needed by the cell.

DNA looks like a long, twisted ladder (it is actually more complicated than that). The "rungs" of the ladder consist of a pair of nucleotides. Nucleotides are actually very small molecules. There are four types of nucleotides: A, C, G and T.

It is easiest to focus on the nucleotides on one side of each rung because the nucleotide on the other side of the rung is always its pair. For example, an "A" is always paired with a "T" and a"C" is always paired with a "G."

For example, if you see an "A" on one side of the rung you know there is a "T" on the other side, and vice versa. Ditto for "C" and "G."

Human DNA consists of about 3 billion "rungs" or pairs of nucleotides. A "rung" will simply be referred to as a "nucleotide" because we only care about the nucleotide on one side of the rung.

On a DNA strand, a "quad" will be defined to be four consecutive nucleotides. Thus, ACCG, TTAC, GGGG, AGGT, etc. are possible "quads."

For example, to generate the charts below this actual sequence of human DNA:

GTGCCCCACAACACCCCTGTGGGTAAGAATGTCACTCATTTCAT

would be broken up into the following "quads":

GTGC CCCA CAAC ACCC CTGT GGGT AAGA ATGT CACT CATT TCAT

As the computer program goes through looking at the DNA, it counts how many times it finds "GTGC" and how many times it finds "CCCA" and so on. Once the final counts are accumulated, the counts are represented by the height of a vertical line. For example, one of the vertical lines below represents how many times the computer program found "GTGC."

There are 256 possible ways to represent four consecutive nucleotides. In the chart below, for each possible quad there is a vertical line (a "bar"). The height of this line, on the chart below, is the result of how many times each quad can be found when analyzing human DNA. This bar chart is called a "histogram."

The chart below is a histogram created by analyzing more than 11,000,000 consecutive quads of human DNA taken from chromosome 5. This means more than 44,000,000 nucleotides were analyzed and are represented in this chart:


Notice that this histogram looks like a mountain range with many very deep valleys and many very tall peaks. The endpoints (AAAA and TTTT) are the most common quads. The next highest quad is ATTT which occurs 117,256 times. The smallest quad, the very small bar slightly to the left of center, is CGCG which occurs only 1,565 times. See Chapter 30 of the main book, in the section "What About DNA?" to see all of the histogram data.

In the next chapter you will see that the above histogram does not look like the histogram of a computer program. That is because human DNA is far, far more sophisticated than a human-written computer program!!

The above chart is what I call "patterns of intelligence." It is a major evidence why the theory of evolution cannot be true.

For those who understand this terminology:
Average Size of Bar: 40,233.76
Standard Deviation: 25,505.06
Standard Deviation as percent of Average Size: 63.39%

Now let us create the same size string of DNA (over 44,000,000 nucleotides), but in this case we will randomly generate each nucleotide. After randomly generating this new string of DNA the following histogram is the result:


Notice that this histogram is as flat as a pancake!! There is nothing even remotely resembling a valley or a mountain peak. There is no intelligence in this histogram!!

For those who understand this terminology:
Average Size of Bar: 40,233.76
Standard Deviation: 204.06
Standard Deviation as percent of Average Size: 0.51% [compared to 63.39% !!!!]

There is literally more than 100 times more variety in real DNA than in computer simulated DNA (based on the ratio of standard deviation to average size)!!

But there are other problems in using randomness. Here is a breakdown of the percentage of times the four different types of nucleotides are found in the DNA sample:

A = 30.74%
C = 19.28%
G = 19.24%
T = 30.74%

You would never get this ratio of nucleotides, given this sample size, using a random number generator. What you would get with randomly generated nucleotides would look close to this:

A = 25.00%
C = 25.00%
G = 25.00%
T = 25.00%

But even the vast differences in the above bar charts totally fail to demonstrate just how massively different real human DNA is compared to randomly generated DNA!!

The reason is that the difference between the above bar charts does not even begin to remotely demonstrate the vast, vast, vast difference in the intelligence built into human DNA versus the mindless nonsense of the randomly generated DNA!! Remember, human DNA includes the morphing of the embryo algorithms!!

In other words, we cannot graphically visualize the massive amount of intelligence built into human DNA (unless we could watch the morphing of the embryo and understood how the DNA makes this happen). But we can graphically demonstrate the lack of intelligence built into mindless randomness - it is flat as a pancake.

The First Living Cell

Evolution must claim that life on this earth started with a single cell which had randomly generated DNA or RNA.

When creating a new species from an old species, the new species will start out with some intelligence on their DNA which was inherited from the DNA of its parent species (according to the theory of evolution).

But the "first living cell" was claimed to be the first life on the planet earth and thus it did not inherit any intelligence from an ancestor species - by definition.

Thus, the entire DNA or RNA of the "first living cell" must have been totally put together randomly!!!! This is because it could not inherit any intelligence from an ancestor species!! Therefore, the flat chart above shows what a histogram of the DNA or RNA of the "first living cell" must have looked like!!

But a flat histogram is not going to create any life!! There could never have been a "first living cell" which was alive!! It could not have passed on any intelligence to its descendant species because it did not have any intelligence.

But this is only the tip of the iceberg with regards to the problems of the "first living cell."

A Paradox of the First Living Cell

Let us look at how a cell gets its energy. The energy of a cell comes from a molecule called ATP or adenosine triphosphate. The way that ATP is made can, in grossly simplified form, be summarized in these steps:

1) Glucose enters into the cell,
2) Glucose is converted into pyruvate [this is roughly a ten step process],
3) Pyruvate enters into the mitochondria,
4) Once inside the mitochondria, the Krebs Cycle or Citric Acid Cycle begins,
5) About half-way trough the Krebs Cycle the Electron Transport Chain (ETC) spins off.

Most of the ATP in a cell is made in the Krebs Cycle and the Electron Transport Chain.

But note the first step of the process: glucose. Where does this glucose come from?

Glucose comes from complex life, such as animals or plants. But the "first living cell" was the first living thing, so where did it get its glucose?

Glucose is not a mineral like quartz, it is only made inside of complex organisms. So the First Living Cell could never have had access to glucose!! This means it could never have created pyruvate or ATP. But without ATP it could not have survived!!

So if there was a "first living cell," it did not use glucose in the creation of its energy. But there are no cells on this planet, that we know of, that do not use glucose.

In addition, how could a cell which does not use glucose evolve into a cell that does use glucose? The internal chemical reactions would be vastly different.

Simple Cells

Scientists realize the total absurdity of claiming that the First Living Cell was anything like the incredibly complex cells of today!! Cells today are far, far more complex than a jet airplane!!

So evolutionists claim the First Living Cell was a "simple cell." This "simple cell" would have had simple metabolism and simple DNA (or RNA). The problem is that there are no "simple" cells on this planet.

I have two college textbooks in my library which are about cell biology. They are both books for introductory courses in the field of cell biology. Both are large books in terms of how much they weigh.

The World of the Cell by Becker, Kleinsmith and Hardin, Fourth Edition, is 11 inches tall and 8 1/2 inches wide. It is 878 pages long, including the index.

Essential Cell Biology - An Introduction to the Molecular Biology of the Cell (Note the word "Introduction") is about the same size, but only has 630 pages (excluding the Glossary and other sections), but it also comes with a CD.

These two books are introductory textbooks, but every year scores of scientists are awarded PhDs in "cellular biology," meaning they get PhDs for making advances in understanding the complexity of what goes on on the surface, inside and outside of cells!!

What goes on inside of a cell is so complex it has taken thousands of scientists to unravel our current understanding of its complexity.

I also have a dictionary called: A Dictionary of Genetics, Seventh Edition, by King, Stansfield and Mulligan. This book has about 400 pages of definitions related to genetics, biology and related fields. In this book there are 10 pages devoted to listing scientific periodicals (i.e. journals) related to genetics, cell biology and evolutionary studies.

Do you get the idea that cell biology and DNA are very, very, very complex subjects!!!

The human body is composed of many trillions of cells. These trillions of cells are composed of many different kinds of cells. It is these many trillions of cells which are the building blocks for the brain, lungs, liver, kidney, blood vessels, etc. etc.

Yet, looking inside of a single cell is like looking at a complex society on a different and distant planet!! I strongly recommend the reader Google the videos: "Inner Life of a Cell" and "Powering the Cell: Mitochondria." Both videos were designed at Harvard University and made by BioVisions. These two videos are a very, very small peak inside the complexity of a living cell.

Are you ready for this: Every type of cell, and the way they are attached to each other, in the body of a newborn baby, had to happen during the morphing of the embryo phase of the fetus!!!

And it all started out with a single fertilized egg with one DNA strand!!

Even the most fanatical evolutionist will admit that a prokaryotic cell and eukaryotic cell could not have formed by a random series of accidents.

Thus evolutionists claim that the "first living cell" was a "simple" cell. But there are no "simple" cells on this planet!!

Thus, they must claim that the "simple" cells are all extinct. How convenient.

But you cannot jump from a "simple" cell (whatever that is) to any of the types of cells on the earth today. Thus, there would have had to have been an "evolution" of many different types of simple cells to get to a complex cell.

But all of those "simple" cells are also extinct. How convenient.

Inside of cells are also very complex molecules. For example, ribosomes are very, very complex molecules which are involved in the conversion from nucleotides to amino acids. How were ribosomes created by evolution?

What the reader needs to do is go to a library and look up a college textbook on cellular biology. Flip through the pages and on every page ask yourself: "how did this feature of the cell come to exist by a series of accidents?" Then, and only then, will you begin to comprehend the absurdity of the theory of evolution.

The more scientists learn about cells, the more ridiculous the theory of evolution becomes. But scientists ignore the absurdities of evolution and continue to push forward with their theories.

The problem is integrity. There is no integrity in the field of evolutionary biology. The few people who do have integrity and admit the theory of evolution is nonsense are ignored or fired.

It is all about status, money, popularity and pride. It is never, never, never about truth!!!

Creating New Species From Old Species

Let us again contemplate the flat histogram above. Even the creation of a new species from an old species would have had to include many large, randomly created or modified sections of DNA. In doing this a species would lose intelligence in its DNA as it was "randomized."

To understand this, let us consider all of the "new" nucleotides on the DNA of a new species. Suppose we lined-up all the new nucleotides side-by-side (even though they may not be side-by-side in the new DNA). A histogram of these side-by-side nucleotides would reveal a flat section of DNA (per the above graph). This is why I said the new DNA would be randomized.

If evolution were true, as the number of "ancestor species" of humans "evolved" from the first living cell (which had a flat histogram to begin with) a histogram of the DNA of each successive ancestor species of humans would have gotten flatter and flatter from one ancestor species to the next. But a histogram of human DNA is not flat.

What is wrong with this picture!!

These are just a few of many reasons that the claims of evolution are total nonsense. Actually, these are some of the mild problems with the theory of evolution at the DNA level, as will be seen later in this book!!

Randomness could never have created the "first living cell" or a new species from an old species.

Chapter 7: Other Histograms of Intelligence

 

 

Chapter Index of Patterns of Intelligence

Chapter 1: The History of the Theory of Evolution
Chapter 2: The Key Definitions
Chapter 3: The Great Deceivers
Chapter 4: Why the Theory of Evolution is False
Chapter 5: The Interaction of Randomness and Natural Selection
Chapter 6: Patterns of Intelligence [This Chapter]
Chapter 7: Other Histograms of Intelligence
Chapter 8: The Location of Mutations (i.e. "Genetic Chaos")
Chapter 9: About the Scientific Establishment
Chapter 10: The Nail in the Coffin of Evolution - Part 1
Chapter 11: The Nail in the Coffin of Evolution - Part 2
Chapter 12: The Iceberg of Evolution
Chapter 13: LDS Doctrine
Chapter 14: The Position of the LDS Church on Evolution

Home Page